Tggagtgtgaccatagcgat Tggagtttgaccatagccat Tggagtgtgaccataaccat Tggtgtttgcccataacgat

Tggagtgtgaccatagcgat Tggagtttgaccatagccat Tggagtgtgaccataaccat Tggtgtttgcccataacgat

1. Take a look at Extended Data Figure 3 from Huerta-Sánchez et al (2014). How does this figure emphasize that the Tibetan allele for EPAS1 came from Denisovans? (10 points)

2. You are given the following seven aligned sequences from a single population (variants with respect to the first sequence are shown in bold). Justify whether or not you see any evidence of selection. (20 points)

TGGAGTGTGACCATAGCGAT
TGGAGTTTGACCATAGCCAT
TGGAGTGTGACCATAACCAT
TGGTGTTTGCCCATAACGAT
TGGTGTGTGACCATAGCGAT
TGGTGTGTGCCCATAGCGAT
TGGAGTGTGACCATAACGAT 

3. Explain the concept of the “Neutral Theory of Molecular Evolution” and how it relates to the idea of a molecular clock? (10 points)

Looking for competent nursing writers for your nursing and medical related classes? Trust ONLY competent nursing writers to handle your writing tasks.
All tasks are done from scratch and we guarantee 100% confidentiality. Order now for15% discount on your first order with us

Use the following coupon
"SAVE15"

Order Now